View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1530_high_16 (Length: 245)
Name: NF1530_high_16
Description: NF1530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1530_high_16 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 7 - 245
Target Start/End: Original strand, 54277416 - 54277654
Alignment:
| Q |
7 |
gagatgaaaaaggtacatagattcaatctaaaacatattgtttcatactaaagttataagtaacataactttcattggnnnnnnncaccaggacgtaagt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
54277416 |
gagatgaaaaaggtacatagattcaatctaaaacatattgtttcatactaaagttataagtaacataactttcattggtttgtttcaccaggaagtaagt |
54277515 |
T |
 |
| Q |
107 |
gaggttgtgactattaatggatatcatgacgtgccacaaaataatgaacaaagcttattgaaggcacttgccaatcaaccactcagtgtggccatagagg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54277516 |
gaggttgtgactattaatggatatcatgacgtgccacaaaataatgaacaaagcttattgaaggcacttgccaatcaaccactcagtgtggccatagagg |
54277615 |
T |
 |
| Q |
207 |
cttcaggcagagatttccagttctatagtggagaatgtt |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
54277616 |
cttcaggcagagatttccagttctatagtggagtatgtt |
54277654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University