View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1530_high_23 (Length: 232)
Name: NF1530_high_23
Description: NF1530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1530_high_23 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 18 - 232
Target Start/End: Complemental strand, 54277946 - 54277732
Alignment:
| Q |
18 |
tccacaaatcccttcagactttccaatgtttctcttcatcctaataaaccctttctcaccccactttgctccccatgaattcttcactataatgtaatcc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54277946 |
tccacaaatcccttcagactttccaatgtttctcttcatcctaataaaccctttctcaccccactttgctccccatgaattcttcactataatgtaatcc |
54277847 |
T |
 |
| Q |
118 |
aaaccctttgatgtaccatatccaacggctgacacaccctgatctagctcacttccacaatgtccatcaaacacaccctacaaatggtagttaaataatc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54277846 |
aaaccctttgatgtaccatatccaacggctgacacaccatgatctagctcacttccacaatgtccatcaaacacaccctacaaatggtagttaaataatc |
54277747 |
T |
 |
| Q |
218 |
agttcatacaattcc |
232 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
54277746 |
agttcatacaattcc |
54277732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University