View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1530_low_13 (Length: 273)
Name: NF1530_low_13
Description: NF1530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1530_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 16 - 263
Target Start/End: Complemental strand, 7415162 - 7414915
Alignment:
| Q |
16 |
aaaataccattagaaattgttgtggagcctagacttgctgatcatctttactccctttgagtattttctctacttaggttttgtgtttaataaggttgag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7415162 |
aaaataccattagaaattgttgtggagcctagacttgctgatcatctttactccctttgagtattttctctacttaggttttgtgtttaataaggttgag |
7415063 |
T |
 |
| Q |
116 |
aattcaacataattggatttgtgtgagtttaatgtcatcatacttaattacaagagcgnnnnnnntgtagacatgataatgaagaagtatatgatgttgg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
7415062 |
aattcaacataattggatttgtgtgagtttaatgtcatcatacttaattacaagagcaaaaaaaatgtaggcatgataatgaagaaatatatgatgttgg |
7414963 |
T |
 |
| Q |
216 |
attgttggaatttacatttagtaatgagtgtagtagtatatccctttg |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7414962 |
attgttggaatttacatttagtaatgagtgtagtagtatatccctttg |
7414915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 16 - 71
Target Start/End: Complemental strand, 7422821 - 7422766
Alignment:
| Q |
16 |
aaaataccattagaaattgttgtggagcctagacttgctgatcatctttactccct |
71 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
7422821 |
aaaataccactagaagttgttgtggagcctagacttcctcatcatctttactccct |
7422766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University