View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1530_low_15 (Length: 249)
Name: NF1530_low_15
Description: NF1530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1530_low_15 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 143 - 249
Target Start/End: Original strand, 6701510 - 6701617
Alignment:
| Q |
143 |
gtgaattctaacggtataaaatagatgatatgacagatggtaaatcagaattcgcttaaacaataggggttcaaa-tatctttaatctcagaattccctc |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |||||| |||||||||||||| ||||||||| |
|
|
| T |
6701510 |
gtgaattctaacggtataaaatagatgatatgtcagatggtaaatcagaattcgcttaaacagtagggtttcaaagtatctttaatctcaaaattccctc |
6701609 |
T |
 |
| Q |
242 |
atgggttt |
249 |
Q |
| |
|
|||||||| |
|
|
| T |
6701610 |
atgggttt |
6701617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University