View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1530_low_17 (Length: 249)
Name: NF1530_low_17
Description: NF1530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1530_low_17 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 13 - 249
Target Start/End: Complemental strand, 25015702 - 25015466
Alignment:
| Q |
13 |
aatatgatatgaacttggtcattaatcaagaactactttaattttgaattagtttccttagtttaaactaagtatctatctctatctgaacggaaatgtt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| | |
|
|
| T |
25015702 |
aatatgatatgaacttggtcattaatcaagaactactttaattttgaattagtttccttagtttatactaagtatctatctctatctgaacggaaatgct |
25015603 |
T |
|
| Q |
113 |
gtttatagcgaaaggatgcttcaccagtcatcccgacatgcttaaaagataactccttaattttttataactgcaatatgtatggttggtgagagccnnn |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
25015602 |
gtttatagcgaaaggatgcttcaccagtcatcccgacatgcttaaaagataactccttaattttttataactgcaatatgtatggtttgtgggagcctct |
25015503 |
T |
|
| Q |
213 |
nnnnngttaccattgcaattagcctttcgcaatggat |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
25015502 |
ttttttttaccattgcaattagcctttcgcaatggat |
25015466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University