View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1530_low_2 (Length: 438)
Name: NF1530_low_2
Description: NF1530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1530_low_2 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 348; Significance: 0; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 348; E-Value: 0
Query Start/End: Original strand, 65 - 428
Target Start/End: Original strand, 27773126 - 27773489
Alignment:
| Q |
65 |
ctgaataatatgctctgacaaatggaggagaatttaatggtaacgtataaaaatatcataaaacattaatggtaagttgaattcctactggttgaggtta |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
27773126 |
ctgaataatatgctctgacaaatggaggagaatttaatgataacgtataaaaatatcataaaacattaatgataagttgaattcctactggttgaggtta |
27773225 |
T |
|
| Q |
165 |
ggaagtcacggtgttactgttagctatagctccgatggttcagcttttggtgtttgagtagttggaacttagaaaatacttatcatagaagtaatgagta |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27773226 |
ggaagtcacggtgttactgttagctatagctccgttggttcagcttttggtgtttgagtagttggaacttagaaaatacttatcatagaagtaatgagta |
27773325 |
T |
|
| Q |
265 |
gttgagctaataatctgtgccagttaaattttgagcctttccatgtgctgacttctgaatcactacactagtagtgtgtagaagctcatgttcatccatc |
364 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27773326 |
gttgagctaataatctgtgccagttaaattttgagcctttccatgtgctgacttctgaatcactacactagtagtgtgtagaagctcatgttcatccatc |
27773425 |
T |
|
| Q |
365 |
aatatcaactggtttatgatttatcaattggattctgcatggttttctgtctccctttgcttct |
428 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27773426 |
aatatcaactggtttatgatttatcaattggattctgcatggttttctgtctccctttgtttct |
27773489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 18 - 52
Target Start/End: Original strand, 27773093 - 27773127
Alignment:
| Q |
18 |
atcacagtcttctatgcaactcatttagataccct |
52 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |
|
|
| T |
27773093 |
atcacattcttctatgcaactcatttagataccct |
27773127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University