View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1530_low_25 (Length: 233)
Name: NF1530_low_25
Description: NF1530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1530_low_25 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 39 - 233
Target Start/End: Original strand, 34669317 - 34669511
Alignment:
| Q |
39 |
ctttcatttcttcaccgccgggaaaattcacaattttccgggaaaattccacccaactatggtttccccggaaaacaccaattggcttttcgattaccct |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34669317 |
ctttcatttcttcaccgccgggaaaattcacaattttccgggaaaattccacccaactatggtttccccggaaaacaccaattggcttttcgattaccct |
34669416 |
T |
 |
| Q |
139 |
ttgattgatgaaattcctgtttctgttgatggctccttcgccttcacgtggcccccacctcacctctccaatggcggggatctgattttttccct |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
34669417 |
ttgattgatgaaattcctgtttctgttgatggctcctttgccttcacgtggcccccacctcacctctccaatggcgggtatctgatttttgccct |
34669511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University