View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1530_low_27 (Length: 226)
Name: NF1530_low_27
Description: NF1530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1530_low_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 6701842 - 6702043
Alignment:
| Q |
1 |
atctaatatatattaagggtgataaaattaaaaatgttgtcttaatctcatcttaagaggatgagttggaagggaaagaatattctaattaattgaagaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6701842 |
atctaatatatattaagggtgataaaattaaaaatgttgtcttaatctcatcttaagaggatgagttggaagggaaagaatattctaattaattgaagaa |
6701941 |
T |
 |
| Q |
101 |
tatgggaattgggaatgaaaatcaaatcacaacgagatgggttgacctaagggtaacttgcatgaaattataatggaatgtctattgcatgcgtcctaca |
200 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
6701942 |
ta-------tgggaatgaaaatcaaatcacaacgagatgggttgacctaagggtaacttgcatgaaattataatggaatgtctattgcatgcgtcctgca |
6702034 |
T |
 |
| Q |
201 |
acctaatat |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
6702035 |
acctaatat |
6702043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University