View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1530_low_28 (Length: 219)
Name: NF1530_low_28
Description: NF1530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1530_low_28 |
 | |
|
| [»] scaffold0542 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0542 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: scaffold0542
Description:
Target: scaffold0542; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 5 - 207
Target Start/End: Complemental strand, 7387 - 7182
Alignment:
| Q |
5 |
atgtcgaagaatatagagaagattaattctgacccagaagtacttgtgattatggctggagaagataaacctacttacatagccaaaccaattattatca |
104 |
Q |
| |
|
||||| ||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7387 |
atgtccaagaacatagagaagattaattctgagccagaagtacttgtgattatggctggagaagataaaccaacttacatagccaaaccaattattatca |
7288 |
T |
|
| Q |
105 |
ctacttctttaccttattgcacttgtggaggtgaatcaacttcaacaacatcttcatcaaccttaaccaatgaggaa---acattgactaattaagttgt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
7287 |
ctacttctttaccttattgcacttgtggaggtgaatcaacttcaacaacatcttcatcaaccttaaccaatgaggaaattacattgactaattaagttgt |
7188 |
T |
|
| Q |
202 |
tgtaag |
207 |
Q |
| |
|
|||||| |
|
|
| T |
7187 |
tgtaag |
7182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University