View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1530_low_7 (Length: 360)
Name: NF1530_low_7
Description: NF1530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1530_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 167 - 357
Target Start/End: Original strand, 34669637 - 34669830
Alignment:
| Q |
167 |
ataaattgttgtggttttcattggtgttcagttatttgttatgttttgtgtacttatgattatgatggatttgtag---aacttgaactaggatggaagt |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34669637 |
ataaattgttgtggttttcattggtgttcagttatttgttatgttttgtgtacttatggttatgatggatttgtagtagaacttgaactaggatggaagt |
34669736 |
T |
 |
| Q |
264 |
acaaagtgttagaagtgtaatttttgaattggttaatgatgatgttcttgaatattctgttctggatatgttggtgggtttaattgtctgtgct |
357 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34669737 |
acaaagtgttagaagtgtaatttttgaattggttaatgatgatgttcttgaatattctgttatggatatgttggtgggtttaattgtctgtgct |
34669830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 31
Target Start/End: Original strand, 34669471 - 34669501
Alignment:
| Q |
1 |
ccacctcacctctccaatggcgggtatctga |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
34669471 |
ccacctcacctctccaatggcgggtatctga |
34669501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University