View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15310_low_3 (Length: 302)
Name: NF15310_low_3
Description: NF15310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15310_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 53 - 257
Target Start/End: Complemental strand, 17230851 - 17230647
Alignment:
| Q |
53 |
aacacaggaattgccaaagatcgaaaagaagacaaagttagttcatgttaatagaggtagaagtatcagaacttaacttcccagagcaactacagatggt |
152 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17230851 |
aacacaagaattgccaaagatcgaaaagaagacaaagttagttcatgttaatagaggtagaagtatcagaacttaacttcccagagcaactacagatggt |
17230752 |
T |
|
| Q |
153 |
tgtggatatgagcattttcagatttttagggggtcttaacagcaatttccaagcataataggcaaagcccattttttatggcagatcgcaattgagtaaa |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
17230751 |
tgtggatatgagcattttcagatttttagggggtcttaacagcaatttccaagcataataggcaaagcccattttttatggcagatcgcaattgagtaga |
17230652 |
T |
|
| Q |
253 |
attta |
257 |
Q |
| |
|
||||| |
|
|
| T |
17230651 |
attta |
17230647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 14 - 59
Target Start/End: Complemental strand, 17231742 - 17231697
Alignment:
| Q |
14 |
atcacaaaatatgctagagtctaaaagtcataactacagaacacag |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
17231742 |
atcacaaaatatgctagagtctaaaagtcataactactgaacacag |
17231697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University