View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15311_high_15 (Length: 391)
Name: NF15311_high_15
Description: NF15311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15311_high_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 4e-94; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 4e-94
Query Start/End: Original strand, 17 - 215
Target Start/End: Complemental strand, 51397458 - 51397260
Alignment:
| Q |
17 |
agcagagaaattgtatgggaaagaaaataacagaataattgtgggtatgcaaaagtgagagcaatgataaagtgtaactcacactttcacacaacattat |
116 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||||| |||||| |||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
51397458 |
agcagagaaattgtacgggaaagaaaataacagaacaattgttggtatgaaaaagtgagagcaatgataaagtgtaactcacacttgcacacaacattat |
51397359 |
T |
|
| Q |
117 |
tacattactagatggtaatacagtttcacatttacatccatcataataatagatgaatttcaaccagttccaagttagaatcttgatctactcgataac |
215 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51397358 |
tacattactagatggcaatacagtttcacatttacatccatcataataatagatgaatttcaaccagttccaagttagaatcttgatctactcgataac |
51397260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 275 - 387
Target Start/End: Complemental strand, 51397201 - 51397089
Alignment:
| Q |
275 |
aaatcaatcatacactgatacacttgcaaaccatattgttgcaaccctttcttctactactctccctctttgaactaaattcgaaaactgaattagaagt |
374 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51397201 |
aaatcaatcatacactgatacacttgcaaaccatattgttgcaaccctttcttctactactctccctctttgaactaaattcgaaaactgaattagaagt |
51397102 |
T |
|
| Q |
375 |
gcgctaccatttg |
387 |
Q |
| |
|
||||||||||||| |
|
|
| T |
51397101 |
gcgctaccatttg |
51397089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University