View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15311_high_17 (Length: 377)
Name: NF15311_high_17
Description: NF15311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15311_high_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 181 - 369
Target Start/End: Complemental strand, 35912952 - 35912764
Alignment:
| Q |
181 |
ataagtgaacacatcttgatgagaagatggaggagacattatgaaacaatcccaacacaatccccactttcacttggcctctcttggggatcatacggct |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35912952 |
ataagtgaacacatcttgatgagaagatggaggagacattatgaaacaatcccaacacaatccccactttcacttggcctctcttggggatcatacggct |
35912853 |
T |
 |
| Q |
281 |
cttagaaatattactcttgttggataacttactttggtagatcaaatcccttctagttatcaccaccactcccatctttgccttcatct |
369 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35912852 |
cttagaaatattactcttgttggataacttactttggtagatcaaatcccttctagttatcaccaccactcccatctttgccttcatct |
35912764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 18 - 144
Target Start/End: Complemental strand, 35913081 - 35912954
Alignment:
| Q |
18 |
tatacatatcaacagaacaaaactttttcttccacctttcatcataccatt-actccttgtacctcccaattgttaacaaactaacaagtagcttttgta |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35913081 |
tatacatatcaacagaacaaaactttttcttccacctttcatcataccatttactccttgcacctcccaattgttaacaaactaacaagtagcttttgta |
35912982 |
T |
 |
| Q |
117 |
caacataagactctaacattaattcctt |
144 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
35912981 |
caacataagactctaacattaattcctt |
35912954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University