View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15311_high_27 (Length: 292)
Name: NF15311_high_27
Description: NF15311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15311_high_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 114; Significance: 7e-58; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 16 - 159
Target Start/End: Original strand, 47763939 - 47764079
Alignment:
| Q |
16 |
aagaaatattaagaaatgaaacaaaatttgctctggagttttaaggtcagtcaactctagagtctaagannnnnnnacctttacaaatttccatctactc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
47763939 |
aagaaatattaagaaatgaaacaaaatttgctctggagttttaaggtcagtcaactcaagagtctaagacccc---acctttacaaatttccatctactc |
47764035 |
T |
 |
| Q |
116 |
ttcattttcgatactccaaagaacaaacattaagcaatggctct |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47764036 |
ttcattttcgatactccaaagaacaaacattaagcaatggctct |
47764079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 162 - 274
Target Start/End: Original strand, 47764406 - 47764518
Alignment:
| Q |
162 |
ttctatttctatgttctctgtttatgataattgtatcccaatccaaagccggagatcctgtatcatgtgataacaacagaggtaattacacagctaatag |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
47764406 |
ttctatttctatgttctctgtttatgataattgtatcccaagccaaagccggagatcctgtatcatgtgataacaacagaggcaattacacagccaatag |
47764505 |
T |
 |
| Q |
262 |
caactacgacaac |
274 |
Q |
| |
|
|| |||||||||| |
|
|
| T |
47764506 |
cacctacgacaac |
47764518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University