View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15311_high_28 (Length: 291)
Name: NF15311_high_28
Description: NF15311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15311_high_28 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 19 - 278
Target Start/End: Complemental strand, 47234770 - 47234511
Alignment:
| Q |
19 |
accaaggatacacagaaacaaaaccgatggaatggtcgtcgagacagattgaacgacgccaagggtgaggtatgcagacatctttgatgaaagtttgagc |
118 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47234770 |
accaaggatacactgaaacaaaaccgatggaatggtcgtcgagacagattgaacgacgccaagggtgaggtatgcagacatctttgatgaaagtttgagc |
47234671 |
T |
|
| Q |
119 |
ttcttcccttgaattgcaagttttccatcggatgttttttgttacttcatcgtcccctgcccataacatgaaattgtcaacgtctgttggcttgaatggc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
47234670 |
ttcttcccttgaattgcaagttttccatcggatgttttttgttacttcatcgtcccctgcccataacatgaaatcgtcaacgtctgttagcttgaatggc |
47234571 |
T |
|
| Q |
219 |
ctcagagatatcctagatagatccacctttgccatgttggtcaaatgatcattgttattc |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47234570 |
ctcagagatatcctagatagatccacctttgccatgttggtcaaatgatcattgttattc |
47234511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University