View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15311_high_36 (Length: 255)
Name: NF15311_high_36
Description: NF15311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15311_high_36 |
 |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0002 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 19 - 146
Target Start/End: Complemental strand, 11539 - 11412
Alignment:
| Q |
19 |
cataggaagcgtggaagacaattttgacttgagttgtatacgttatgagttggatatatcccagaacccgcagcttctgctgtttgtaagtatatggttt |
118 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
11539 |
cataggaagcgtagaagacaattttgacttgagttgtattcgttatgagttggatatatcccataacccgaagcttctgctgtttgtaagtatatggttt |
11440 |
T |
 |
| Q |
119 |
ccattaattgattgcatgtttgattgtc |
146 |
Q |
| |
|
|||||||||||||| ||||||||||||| |
|
|
| T |
11439 |
ccattaattgattgtatgtttgattgtc |
11412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University