View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15311_high_9 (Length: 439)
Name: NF15311_high_9
Description: NF15311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15311_high_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 258; Significance: 1e-143; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 138 - 423
Target Start/End: Complemental strand, 47996264 - 47995979
Alignment:
| Q |
138 |
atgtcacccttcaatcttcattgatgatgttatatatacgtaggtttggattcttggcagcactgctccttcttgttggaatcaaatgcaaaagattggt |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
47996264 |
atgtcacccttcaatcttcattgatgatgttatatatacgtacgtttggattcttggcagcactgctccttcttgatggaatcaaatgcaaaagattggt |
47996165 |
T |
|
| Q |
238 |
tttgaaaccaatttgattgttctcaaaatgacaaggttgatcctcgtcaatcttacccatctttttcacctcggtattgcttttataccccaaagttgat |
337 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
47996164 |
tttgaaaccaatttgattgctctcaaaatgacaaggttgatcctcgtcaatcttacccatctttttcacctcagtattgcttttataccccaaatttgat |
47996065 |
T |
|
| Q |
338 |
tgtttttgcctcgatgcaatatgatttcctccattcgcgttgatgttgtttggcttaggcaagtgtggaatgtgatttgcagctcc |
423 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47996064 |
tgtttttgcctcgatgcaatatgatttcctccattcgtgttgatgttgtttggcttaggcaagtatggaatgtgatttgcagctcc |
47995979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 9 - 95
Target Start/End: Complemental strand, 47996405 - 47996316
Alignment:
| Q |
9 |
agcaaaggttgaattattaatctagagtctac---actcttgatcttgataatcgctcaaattattctagcacgtgcatgctcactcacc |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
47996405 |
agcaaaggttgaattattaatctagagtctactacactcttgatcttgataatcgctcaaattattccagcaagtgcatgctcactcacc |
47996316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University