View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15311_low_30 (Length: 307)
Name: NF15311_low_30
Description: NF15311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15311_low_30 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 139; Significance: 9e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 139; E-Value: 9e-73
Query Start/End: Original strand, 1 - 139
Target Start/End: Complemental strand, 41649631 - 41649493
Alignment:
| Q |
1 |
gatatggataacataaaaatattaagaagaccaaatgtaagacttttatttgagtttgtcttgtatgagtcatttattttcaactgcttgatagtttctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41649631 |
gatatggataacataaaaatattaagaagaccaaatgtaagacttttatttgagtttgtcttgtatgagtcatttattttcaactgcttgatagtttctc |
41649532 |
T |
 |
| Q |
101 |
acgaagaaattttatttagttgttcacacataatacaac |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41649531 |
acgaagaaattttatttagttgttcacacataatacaac |
41649493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University