View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15311_low_43 (Length: 249)
Name: NF15311_low_43
Description: NF15311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15311_low_43 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 14 - 166
Target Start/End: Original strand, 35318545 - 35318697
Alignment:
| Q |
14 |
agaagaaaagggtccatttatgtctaactccctttcatttaccaaatcaggataactaaaccactcactttcttctctttgcttttattcacgttttctt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
35318545 |
agaagaaaagggtccatttatgtctaactccctttcatttaccaaatgaggataactaaaccacttactttcttctctttgcttttattcacgttttctt |
35318644 |
T |
 |
| Q |
114 |
aattttttagttaaaccaaatcccaaaccttttttcccttgcatgaaatgtag |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35318645 |
aattttttagttaaaccaaatcccaaaccttttttcccttgcatgaaatgtag |
35318697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 193 - 234
Target Start/End: Original strand, 35318716 - 35318757
Alignment:
| Q |
193 |
aacaatctaaactataggtaaaataattttaaatttgtgtgt |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35318716 |
aacaatctaaactataggtaaaataattttaaatttgtgtgt |
35318757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University