View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15311_low_44 (Length: 233)
Name: NF15311_low_44
Description: NF15311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15311_low_44 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 13 - 217
Target Start/End: Complemental strand, 6207684 - 6207481
Alignment:
| Q |
13 |
aagaatataagttcctcaactcatgcttgtgatcaatttacttgaaatttttcgttttgttgtgaaataaagtataggaaaattgtgttaatgtgaacgt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6207684 |
aagaatataagttcctcaactcatgcttgtgatcaatttacttgaaatttttcgttttgttgtgaaataaagtataggaaaag-gtgttaatgtgaacgt |
6207586 |
T |
 |
| Q |
113 |
catcattttctttattttacttcttggacaaaatttatgtataatttcatagacaccgttattacaaacttacagttctctactaaaataaaataggctt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6207585 |
catcattttctttattttacttcttggacaaaatttatgtataatttcatagacaccgttattacaaacttacagttctctactaaaataaaataggctt |
6207486 |
T |
 |
| Q |
213 |
aatag |
217 |
Q |
| |
|
||||| |
|
|
| T |
6207485 |
aatag |
6207481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University