View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15312_high_4 (Length: 350)
Name: NF15312_high_4
Description: NF15312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15312_high_4 |
 | |
|
| [»] scaffold0693 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0693 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: scaffold0693
Description:
Target: scaffold0693; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 228 - 348
Target Start/End: Complemental strand, 3829 - 3709
Alignment:
| Q |
228 |
ccttcaaacgcaggaccctctttggagagtacattcttaatactttgtaagctgagatagttgatatcatagccattaaaatggatgctatatagcagca |
327 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3829 |
ccttcaaacgcaggaacctctttggagagtacattcttaatactttgtaagctgagatagttgatatcatagccattaaaatggatgctatatagcagca |
3730 |
T |
|
| Q |
328 |
taatattgcccctccaatttg |
348 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
3729 |
taatattgcccctccaatttg |
3709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0693; HSP #2
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 1 - 189
Target Start/End: Complemental strand, 4128 - 3931
Alignment:
| Q |
1 |
tctaaggagaggagcagttctcttgtttttattcaacagaggaaacaaaacttgcatt---------gaatgttcaaataatacttttgtacaaattnnn |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
4128 |
tctaaggagaggagcagttctcttgtttttattcaacagaggaaacaaaacttgcattaattaaattgaatattcaaataatacttttgtacaaattaaa |
4029 |
T |
|
| Q |
92 |
nnnnnnnnnnnggaggagaagagacaaattcaaacaatattaggaaccgacaataaatgcaaccagctatgtgtacctatccctcttgcttgcacacg |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4028 |
aaaataaaaaaggaggagaagagacaaattcaaacaatattaggaaccgacaataaatgcaactagctatgtgtacctatccctcttgcttgcacacg |
3931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University