View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15312_low_13 (Length: 229)
Name: NF15312_low_13
Description: NF15312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15312_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 38 - 180
Target Start/End: Complemental strand, 2747937 - 2747797
Alignment:
| Q |
38 |
tgttgcagatgaaaaccatgaatcacaacatggtaaacaaatttgatcggttatggtgtaatatcttgatattttctgtcttcattaaactttatattat |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2747937 |
tgttgcagatgaaaaccatgaatcacaacatggtaaacaaatttgatcggttatggtgtaatatcttgatattttctgtcttcattaaactttatattat |
2747838 |
T |
 |
| Q |
138 |
ccatataccggtctaatgcagcacccgaatggaaggatacggt |
180 |
Q |
| |
|
|| ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2747837 |
cc--ataccggtctaatgcagcacccgaatggacggatacggt |
2747797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 73 - 180
Target Start/End: Complemental strand, 2755945 - 2755841
Alignment:
| Q |
73 |
aacaaatttgatcggttatggtgtaatatcttgatatttt-ctgtcttcattaaactttatattatccatataccggtctaatgcagcacccgaatggaa |
171 |
Q |
| |
|
||||||||||||| ||||||||||||| ||| ||||||| |||| |||||| ||||||||| || |||| | ||||||||||||| |||||| ||| |
|
|
| T |
2755945 |
aacaaatttgatcagttatggtgtaat--cttaatatttttctgttttcattgaactttataacatgcata--ctggtctaatgcagcccccgaacggac |
2755850 |
T |
 |
| Q |
172 |
ggatacggt |
180 |
Q |
| |
|
||||||||| |
|
|
| T |
2755849 |
ggatacggt |
2755841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University