View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15312_low_15 (Length: 204)
Name: NF15312_low_15
Description: NF15312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15312_low_15 |
 | |
|
| [»] scaffold0693 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0693 (Bit Score: 181; Significance: 5e-98; HSPs: 1)
Name: scaffold0693
Description:
Target: scaffold0693; HSP #1
Raw Score: 181; E-Value: 5e-98
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 3201 - 3394
Alignment:
| Q |
1 |
tgctgggtataacatgcttcaattatgcaaacactctttctcagcttgttctacaatacggaacttcaatgattcttattatatgcacatggcttggatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3201 |
tgctgggtataacatgcttcaattatgcaaacactctttctcagcttgttctacaatacggaacttcaatgattcttattatatgcacatggcttggatt |
3300 |
T |
|
| Q |
101 |
agtttcttactagatcaggtaaattaactcttttcttatttagttgagaatacatattatatatattaaacttggttatacatgataatataaggtat |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3301 |
agtttcttactagatcaggtaaattaactct----ttatttagttgagaatacatattatatatattaaacttggttatacatgataatataaggtat |
3394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University