View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15313_low_4 (Length: 238)
Name: NF15313_low_4
Description: NF15313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15313_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 15 - 221
Target Start/End: Complemental strand, 51555464 - 51555258
Alignment:
| Q |
15 |
gcactttgaacaatcgggtcaacctaaaaagaaattagaaataatgggtcacgaaaattacgaagaaaagagatgaatttagagaaacccattaacctga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51555464 |
gcactttgaacaatcgggtcaacctaaaaagaaattagaaataatgggtcacgaaaattacgaagaaaagagatgaatttagagaaacccattaacctga |
51555365 |
T |
 |
| Q |
115 |
agttgttctacgggtaaaggaccgtgttgaatctcttcggtttcttggtcgtgttgttgtgctgttttctcaagtcgttgttgctccatggtttaaagat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51555364 |
agttgttctacgggtaaaggaccgtgttgaatctcttccgtttcttggtcgtgttgttgtgctgttttctcaagtcgttgttgctccatggtttaaagat |
51555265 |
T |
 |
| Q |
215 |
tcgatct |
221 |
Q |
| |
|
||||||| |
|
|
| T |
51555264 |
tcgatct |
51555258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University