View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15314_high_5 (Length: 210)
Name: NF15314_high_5
Description: NF15314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15314_high_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 45793486 - 45793684
Alignment:
| Q |
1 |
gttaaatttcaattatttttcttaacaaatctaaagctaagccgattagagtactagattgccattttttcatagtcttggctgccatgtttttcagagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45793486 |
gttaaatttcaattatttttcttaacaaatctaaagctaagccgattagagtactagattgccattttttcatagtcttggctgccatgtttttcagagt |
45793585 |
T |
|
| Q |
101 |
tggagatttgattggtatattaactgactattggtatgcgtttggggatataatttagaatttaggagtatagtatattatgtgctctgagtgattcat |
199 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45793586 |
tggagatttggttggtatattaactgactattggtatgcgtttggggatataatttagaatttaggagtatagtatattatgtgctctgagtgattcat |
45793684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University