View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15314_low_3 (Length: 362)
Name: NF15314_low_3
Description: NF15314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15314_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 15 - 217
Target Start/End: Original strand, 26211192 - 26211394
Alignment:
| Q |
15 |
gagatgaacgtggcggtagaggtcgttgagttcgacgccgcagtaaccattgaattcgggaatttcaaagtatgagtatggagaaagaagatcttgaagt |
114 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26211192 |
gagatggacgtggcggtagaggtcgttgagttcgacgccgcagtaaccgttgaattcgggaatttcaaagtatgagtatggagaaagaagatcttgaagt |
26211291 |
T |
 |
| Q |
115 |
gattcgtacagtgaatgaagcactgagagaagctgtgttggaagtacgttttggagaactgttagtaaccctaacaatgaccacatttgtgacaatatct |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26211292 |
gattcgtacagtgaatgaagcactgagagaagctgtgttggaagtacgttttggagaactgttagtaaccctaacaatgaccacatttgtgacaatatct |
26211391 |
T |
 |
| Q |
215 |
cca |
217 |
Q |
| |
|
||| |
|
|
| T |
26211392 |
cca |
26211394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 260 - 306
Target Start/End: Original strand, 26211437 - 26211483
Alignment:
| Q |
260 |
aataattgaataggaacgtgaatgagaatgtttctttttgaggttgt |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26211437 |
aataattgaataggaacgtgaatgagaatgtttctttttgaggttgt |
26211483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University