View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15314_low_7 (Length: 238)
Name: NF15314_low_7
Description: NF15314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15314_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 18 - 227
Target Start/End: Complemental strand, 50631287 - 50631081
Alignment:
| Q |
18 |
atgccaagctcgtctaatgtggtagcaaaactaggttaaggatgacaatagggaattagacccaggagcttagataagtgtgagctcgggtattaaagtt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
50631287 |
atgccaagctcgtctaatgtggtagcaaaactaggttaaggatgacaatagggaattagacccaggaacttggataagtgtgagctcgggtattaaagtt |
50631188 |
T |
 |
| Q |
118 |
ggagttccacattggcaaggttctcaaattgttggatgaatatatgtgtgtggggcattatcatctaatgagctaacttttaagagcgatattcatttag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| ||||| |||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50631187 |
ggagttccacattggcaaggttctcaaattattggatgaatatgtgtgt---gggcatcatcatctaatgagctaacttttaagagcgatattcatttag |
50631091 |
T |
 |
| Q |
218 |
ttggagtatt |
227 |
Q |
| |
|
|||||||||| |
|
|
| T |
50631090 |
ttggagtatt |
50631081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University