View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15315_high_17 (Length: 336)
Name: NF15315_high_17
Description: NF15315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15315_high_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 1 - 326
Target Start/End: Original strand, 25697972 - 25698297
Alignment:
| Q |
1 |
ttgttgtggaagaaagggtgaatgtcctaaggctagtttggtttcagggtatgatactgaagctggttttgattattgttcgtgttcgcgaaaaaataat |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25697972 |
ttgttgtggaagaaaggttgaatgtcctaaggctagtttggtttcagggtatgatactgaacctggttttgattattgttcgtgttcgcgaaaaaataat |
25698071 |
T |
|
| Q |
101 |
attattgttgataatgttgatgtggaatgtgaatgctcaacttcttatgaagatggtgattgccatgatatgtctttttgtataggtgatagtgaaatta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25698072 |
attattgttgataatgttgatgtggaatgtgaatgctcaacttcttatgaagatggtgattgccatgatatgtctttttgtataggtgatagtgaaatta |
25698171 |
T |
|
| Q |
201 |
ggtgtagtaggtattttatggcgtcgctttcgaggccttttatgacaatgttgtatggtggatttgttgagtctaggagggagaagataagtttttctct |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
25698172 |
ggtgtagtaggtattttatggcgtcgctttcgaggccttttatgacaatgttgtatggtggatttgttgagtctaggagggagaagataattttttctct |
25698271 |
T |
|
| Q |
301 |
taatgatttttctgttgaggtgatga |
326 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
25698272 |
taatgatttttctgttgaggtgatga |
25698297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 167 - 264
Target Start/End: Complemental strand, 4182387 - 4182290
Alignment:
| Q |
167 |
gatatgtctttttgtataggtgatagtgaaattaggtgtagtaggtattttatggcgtcgctttcgaggccttttatgacaatgttgtatggtggatt |
264 |
Q |
| |
|
||||| || |||||||| |||||| ||||||||||||| |||||| |||||| |||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
4182387 |
gatatatcgttttgtatcggtgatgatgaaattaggtgtggtaggttcaatatggcttcgctttcgaggccgtttaagacaatgttgtatggtggatt |
4182290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University