View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15315_high_9 (Length: 406)
Name: NF15315_high_9
Description: NF15315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15315_high_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 79; Significance: 8e-37; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 311 - 389
Target Start/End: Complemental strand, 5039351 - 5039273
Alignment:
| Q |
311 |
atagacctgcactattgtagtcttgctaagtatgtggacttcataagaaagtaacaaaatgaatattgaagaaacagct |
389 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5039351 |
atagacctgcactattgtagtcttgctaagtatgtggacttcataagaaagtaacaaaatgaatattgaagaaacagct |
5039273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 273
Target Start/End: Complemental strand, 5039402 - 5039351
Alignment:
| Q |
222 |
tataaaagatttataaacaaatctaggtcataccttattctaaatttcaaaa |
273 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5039402 |
tataaaagatttgtaaacaaatctaggtcataccttattctaaatttcaaaa |
5039351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University