View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15315_low_27 (Length: 292)
Name: NF15315_low_27
Description: NF15315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15315_low_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 13 - 281
Target Start/End: Complemental strand, 53477518 - 53477250
Alignment:
| Q |
13 |
acatacactatctcaaattgtgggatattgcttttgagttgctcgtagattccaatgagcaattgagtgaatccacgacatggtgggtaccagttggcag |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53477518 |
acatacactatctcaaattgtgggatattgcttttgagttgctcgtagattccaatgagcaattgagtgaatccacgacatggtgggtaccagttggcag |
53477419 |
T |
 |
| Q |
113 |
cgaataatagacctactacttttccttcaagttctgatattttaacctacatgcaagaccaccatctacattaatgtaacatcttgtaaggaataatgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53477418 |
cgaataatagacctactacttttccttcaagttctgatattttaacctacatgcaagaccaccatctacattaatgtaacatcttgtaaggaataatgta |
53477319 |
T |
 |
| Q |
213 |
atgtaatgtaatgaccactccctcttcacacaaacattgccacataatatgtcatttcacgcgaatatt |
281 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
53477318 |
atgtcatgtaatgaccactccctcttcacacaaacattgccacataatatgtcatttcacgcaaatatt |
53477250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University