View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15315_low_33 (Length: 237)
Name: NF15315_low_33
Description: NF15315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15315_low_33 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 96; Significance: 3e-47; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 127 - 222
Target Start/End: Original strand, 104534 - 104629
Alignment:
| Q |
127 |
gtaactgatgggatacattcattaaataattttcctgtcaatacaatgcagagttttggtagccaagaatgggatgctggttttgccgttcaagct |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
104534 |
gtaactgatgggatacattcattaaataattttcctgtcaatacaatgcagagttttggtagccaagaatgggatgctggttttgccgttcaagct |
104629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 104088 - 104137
Alignment:
| Q |
1 |
aagggtccaagattacttgtggatgtcagaagatggaatgaccatgcagg |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
104088 |
aagggtccaagattacttgtggatgtcagaagatggaatgaccatgcagg |
104137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 165065 - 165114
Alignment:
| Q |
1 |
aagggtccaagattacttgtggatgtcagaagatggaatgaccatgcagg |
50 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
165065 |
aagggtcccagattacttgtggatgtcagaagatggaatgaccatgcagg |
165114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 134 - 222
Target Start/End: Original strand, 165147 - 165235
Alignment:
| Q |
134 |
atgggatacattcattaaataattttcctgtcaatacaatgcagagttttggtagccaagaatgggatgctggttttgccgttcaagct |
222 |
Q |
| |
|
|||| ||| ||||| ||||||| ||| | ||||||||||||||| |||||| ||||||| ||||||| || |||||||| |||||||| |
|
|
| T |
165147 |
atggaatatattcagtaaataacttttgtatcaatacaatgcagacttttgggagccaagtatgggatactagttttgccattcaagct |
165235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 167 - 222
Target Start/End: Original strand, 13053143 - 13053198
Alignment:
| Q |
167 |
atacaatgcagagttttggtagccaagaatgggatgctggttttgccgttcaagct |
222 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||| |||||||| ||||||||| |
|
|
| T |
13053143 |
atacaatgtagagttttggtagtcaagaatgggatgcaggttttgctgttcaagct |
13053198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 13052978 - 13053027
Alignment:
| Q |
1 |
aagggtccaagattacttgtggatgtcagaagatggaatgaccatgcagg |
50 |
Q |
| |
|
|||||||| ||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
13052978 |
aagggtcccagattacttgtgggtttcagaagatggaatgaccatgcagg |
13053027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 165 - 219
Target Start/End: Complemental strand, 12137042 - 12136988
Alignment:
| Q |
165 |
caatacaatgcagagttttggtagccaagaatgggatgctggttttgccgttcaa |
219 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||| |||||||||| ||||| |
|
|
| T |
12137042 |
caatataatgcagagttttggtagccaaaaatgggatgttggttttgccattcaa |
12136988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University