View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15316_low_10 (Length: 238)
Name: NF15316_low_10
Description: NF15316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15316_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 12 - 220
Target Start/End: Original strand, 11831896 - 11832105
Alignment:
| Q |
12 |
tgagaagaatttaaagacaaaaatagccacaagatttggtgaagacacacaaactccacgaccccacctatcacgcatgcatactacatatatttgcatc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11831896 |
tgagaagaatttaaagacaaaaatagccacaagatttggtgaagacacacaaactccacgaccccacctatcacgcatgcatactacatatatttgcatc |
11831995 |
T |
|
| Q |
112 |
tagatcctctcctgtgttgtcctcttcact-atcaagtcttatttttctttactatactctttagataagaagattgaagacggtccaagtatttgccat |
210 |
Q |
| |
|
| ||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
11831996 |
tggatcctctcctgtgtagtcctcttcactaatcaagtcttatttttctttactatactctttaggttagaagattgaagacggtccaagtatttgccat |
11832095 |
T |
|
| Q |
211 |
acagtgcatt |
220 |
Q |
| |
|
|||||||||| |
|
|
| T |
11832096 |
acagtgcatt |
11832105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University