View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15317_high_25 (Length: 290)
Name: NF15317_high_25
Description: NF15317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15317_high_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 1 - 274
Target Start/End: Complemental strand, 34572317 - 34572044
Alignment:
| Q |
1 |
tacaatcttaatgtagttcttttcgcgccggattcacagtttaggaaagatttagcagaacatcaagggacaacaaatttgcaagaaggggcttggtcct |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34572317 |
tacaatcttaatgtagttcttttcgtgccggattcacagtttaggaaagatttagcagaacaacaagggacaacaaatttgcaagaaggggcttggtcct |
34572218 |
T |
|
| Q |
101 |
ggaaagatgaagatatgtcttgtttgactcgagtcgtcaactatacaaaagctgcttcaaaattggttaaagctctcaataccaccgaggaacaaaccta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34572217 |
ggaaagatgaagatatgtcttgtttgactcgagtcgtcaactatacaaaagctgcttcaaaattggttaaagctctcaataccactgaggaacaaaccta |
34572118 |
T |
|
| Q |
201 |
tattagagcgactaaagatgaatttgatgtacttgttagtgtatgcacccctgaggttccttatgggaattcat |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34572117 |
tattagagcgactaaagatgaatttgatgtacttgttagtgtatgcacccctgaggttccttatgggaattcat |
34572044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University