View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15317_high_28 (Length: 264)
Name: NF15317_high_28
Description: NF15317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15317_high_28 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 58; Significance: 2e-24; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 182 - 243
Target Start/End: Complemental strand, 29479392 - 29479331
Alignment:
| Q |
182 |
tactattattgttttcatttgaagagaatgtttcctttcttcttgaattgtattgtatgcca |
243 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29479392 |
tactactattgttttcatttgaagagaatgtttcctttcttcttgaattgtattgtatgcca |
29479331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 180 - 238
Target Start/End: Complemental strand, 29515256 - 29515198
Alignment:
| Q |
180 |
attactattattgttttcatttgaagagaatgtttcctttcttcttgaattgtattgta |
238 |
Q |
| |
|
|||||||||||||||| |||||||| |||||| | ||||||||||||||||||||||| |
|
|
| T |
29515256 |
attactattattgtttacatttgaacagaatgctatctttcttcttgaattgtattgta |
29515198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 238
Target Start/End: Complemental strand, 29527584 - 29527528
Alignment:
| Q |
182 |
tactattattgttttcatttgaagagaatgtttcctttcttcttgaattgtattgta |
238 |
Q |
| |
|
||||||||||||| |||||||| |||||| || |||||| |||||||||||||||| |
|
|
| T |
29527584 |
tactattattgttgacatttgaacagaatgcttgctttctgcttgaattgtattgta |
29527528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 51
Target Start/End: Complemental strand, 3751370 - 3751336
Alignment:
| Q |
17 |
tactatgtctatggttcattggtgttagattgtgc |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
3751370 |
tactatgtctatggttcattggtgttagatcgtgc |
3751336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University