View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15317_high_37 (Length: 234)
Name: NF15317_high_37
Description: NF15317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15317_high_37 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 9 - 229
Target Start/End: Complemental strand, 27380653 - 27380433
Alignment:
| Q |
9 |
gagaagaaacttccacttatagtttcatatcttaccaaccctttattctctattcaaacaaatgataatgttcttgctaaaaatgaatctgttgaaattc |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
27380653 |
gagaagaaacttccacttatagtttcatatcttaccaaccctttattctctattcaaacaaatgatattgttcttgctaaaaatgaatctgttgaaattc |
27380554 |
T |
 |
| Q |
109 |
acgaagaaaaaccactccttttgaagtttaaacactacccttttggttcttagacatgtttcattctacaaagatgatgaaattcagcagcatatatttg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27380553 |
acgaagaaaaaccactccttttgaagtttaaacactacccttttggttcttagacatgtttcattctacaaagatgatgaaattcagcagcatatatttg |
27380454 |
T |
 |
| Q |
209 |
ttgtttgtgatattttttggt |
229 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
27380453 |
ttgtttgtgatattttttggt |
27380433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University