View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15317_low_10 (Length: 471)

Name: NF15317_low_10
Description: NF15317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15317_low_10
NF15317_low_10
[»] chr5 (1 HSPs)
chr5 (15-79)||(28742200-28742264)


Alignment Details
Target: chr5 (Bit Score: 57; Significance: 1e-23; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 15 - 79
Target Start/End: Original strand, 28742200 - 28742264
Alignment:
15 attcagaacatgatctagcagcacaccaacaagccgccactaacaccgcgcatagacaatatgta 79  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||    
28742200 attcagaacatgatctagcaacacaccaacaagccgccactaacaccgctcatagacaatatgta 28742264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University