View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15317_low_17 (Length: 406)
Name: NF15317_low_17
Description: NF15317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15317_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-118; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 156 - 390
Target Start/End: Complemental strand, 31959504 - 31959269
Alignment:
| Q |
156 |
agggcatgtagaagaaattaatggatacaaaaagaggaatggagaatttacacttgtcatgcaagggaaagatgaatgttccatgtttggaggtacaggt |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31959504 |
agggcatgtagaagaaattaatggatacaaaaagaggaatggagaatttacacttgtcatgcaagggaaagatgattgttccatgtttggaggtacaggt |
31959405 |
T |
 |
| Q |
256 |
ggcatttgaagcagcatagtgcatgcagcatgacacatagaagaccaatgttgtatgcatgcagaacacgaattctaaagacagattaagctggtgatct |
355 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31959404 |
ggcatttgaagcagcaaagtgcatgcagcatgacacatagaagaccaattttgtatgcatgcagaacacgaattctaaagacagattaagctggtgatct |
31959305 |
T |
 |
| Q |
356 |
ctagaactaaacacacgttatccttct-tttctttt |
390 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31959304 |
ctagaactaaacacacgttatccttctctttctttt |
31959269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 31959624 - 31959516
Alignment:
| Q |
1 |
aattgttctgcttgtggtctctgtggctgttcttgactcatgattctgcactttgattttgatgctttacgtttcctagatcgatattgtgtgataattt |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31959624 |
aattgctctgcttgtggtctctgtggctgttcttgactcatgattctgcactttgattttgatgctttacgtttcctagatcgatattgtgtgataattt |
31959525 |
T |
 |
| Q |
101 |
attgcagtg |
109 |
Q |
| |
|
||||||||| |
|
|
| T |
31959524 |
attgcagtg |
31959516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University