View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15317_low_23 (Length: 345)
Name: NF15317_low_23
Description: NF15317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15317_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 321; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 1 - 337
Target Start/End: Complemental strand, 34572630 - 34572294
Alignment:
| Q |
1 |
tgaacgtcttcacatttcatctcatcaatcttttcataaaaatcgtaaaatgggtgaaggcaaacatttgttgaaggctatcgctaatcgcatagaaagg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
34572630 |
tgaacgtcttcacatttcatctcatcaatcttttcataaaaatcgtaaaatgggtgaaggcaaacatttgttgaaggctatcgctgatcgcttagaaagg |
34572531 |
T |
|
| Q |
101 |
attttacataagaaagaacgaaactcaaaacccgtggattgttcagaaacatcaaattcattgtctgattacgaagatagtgttcaagaaaattcacccc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34572530 |
attttacataagaaagaacgaaactcaaaacccgtggattgttcagaaacatcaaattcattgtctgattacgaagatagtgttcaagaaaattcacccc |
34572431 |
T |
|
| Q |
201 |
cttgtagttttgaagaaggcattgcactaatgctgtcaagagataaccaaccagaaagtcctgaaaatttacagggtggtattttagtagataagattta |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34572430 |
cttgtagttttgaagaaggcattgcactaatgcagtcaagagataaccaaccagaaagtcctgaaaatttgcagggtggtattttagtagataagattta |
34572331 |
T |
|
| Q |
301 |
tgaagtatctccatacaatcttaatgtagttcttttc |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34572330 |
tgaagtatctccatacaatcttaatgtagttcttttc |
34572294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University