View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15317_low_27 (Length: 316)
Name: NF15317_low_27
Description: NF15317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15317_low_27 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 17 - 304
Target Start/End: Original strand, 44499691 - 44499978
Alignment:
| Q |
17 |
aatttatgcacaataaatatttcaaaagtcacatccattaacttctccatgaataccaataaatttatcagaacttttcttattagttggaaaaaactag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44499691 |
aatttatgcacaataaatatttcaaaagtcacatccattaacttctccatgaataccaataaatttatcagaacttttcttattagttggaaaaaactag |
44499790 |
T |
|
| Q |
117 |
taattatctcagttgctagatactaattcaaaatgatcctatatttcaaatgcacgccagcnnnnnnnacatgttggcagcaaatgcttataagttagaa |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
44499791 |
taattatctcagttgctagatactaattcaaaatgatcctatatttcaaatgcacgccagctttttttacatgttggcagcaaatgcttataagttagaa |
44499890 |
T |
|
| Q |
217 |
gttaactcaaattggcacaaaaaacgattaaagaagcaatgcacacgcacgcacaaacatatattcatagagtatcaacaagcagtat |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44499891 |
gttaactcaaattggcacaaaaaacgattaaagaagcaatgcacacgcacgcacaaacatatattcatagagtatcaacaagcagtat |
44499978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University