View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15317_low_31 (Length: 287)
Name: NF15317_low_31
Description: NF15317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15317_low_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 18 - 277
Target Start/End: Complemental strand, 50666550 - 50666291
Alignment:
| Q |
18 |
gtctcatgagactctctatctttgctctctgtatttttcatcgtagcaacttctgtttagagaattatatcaaaacaaggtcaatttctcaaaatcccta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50666550 |
gtctcatgagactctctatctttgctctctatatttttcatcgtagcaacttctgtttagagaattatatcaaaacaaggtcaatttctcaaaatcccta |
50666451 |
T |
|
| Q |
118 |
aaaacaaagcaatttattcaaaggttttaaaccctaatcccctaaaccgtgaagatttgaataattagtgtgattgagggtttaatttcatcaaagtatc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50666450 |
aaaacaaagcaatttattcaaaggttttaaaccctaatcccctaaaccgtgaagatttgaataattagtgtgattgagggtttaatttcatcaaagtatc |
50666351 |
T |
|
| Q |
218 |
taaagaaggtttaaaaccctaaacaccaattcgtaattcacgattcacaacagattcatc |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50666350 |
taaagaaggtttaaaaccctaaacaccaattcgtaattcacgattcacaacagattcatc |
50666291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University