View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15317_low_33 (Length: 264)

Name: NF15317_low_33
Description: NF15317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15317_low_33
NF15317_low_33
[»] chr6 (3 HSPs)
chr6 (182-243)||(29479331-29479392)
chr6 (180-238)||(29515198-29515256)
chr6 (182-238)||(29527528-29527584)
[»] chr4 (1 HSPs)
chr4 (17-51)||(3751336-3751370)


Alignment Details
Target: chr6 (Bit Score: 58; Significance: 2e-24; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 182 - 243
Target Start/End: Complemental strand, 29479392 - 29479331
Alignment:
182 tactattattgttttcatttgaagagaatgtttcctttcttcttgaattgtattgtatgcca 243  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29479392 tactactattgttttcatttgaagagaatgtttcctttcttcttgaattgtattgtatgcca 29479331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 180 - 238
Target Start/End: Complemental strand, 29515256 - 29515198
Alignment:
180 attactattattgttttcatttgaagagaatgtttcctttcttcttgaattgtattgta 238  Q
    |||||||||||||||| |||||||| |||||| |  |||||||||||||||||||||||    
29515256 attactattattgtttacatttgaacagaatgctatctttcttcttgaattgtattgta 29515198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 238
Target Start/End: Complemental strand, 29527584 - 29527528
Alignment:
182 tactattattgttttcatttgaagagaatgtttcctttcttcttgaattgtattgta 238  Q
    |||||||||||||  |||||||| |||||| || |||||| ||||||||||||||||    
29527584 tactattattgttgacatttgaacagaatgcttgctttctgcttgaattgtattgta 29527528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 51
Target Start/End: Complemental strand, 3751370 - 3751336
Alignment:
17 tactatgtctatggttcattggtgttagattgtgc 51  Q
    |||||||||||||||||||||||||||||| ||||    
3751370 tactatgtctatggttcattggtgttagatcgtgc 3751336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University