View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15317_low_37 (Length: 247)
Name: NF15317_low_37
Description: NF15317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15317_low_37 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 15 - 227
Target Start/End: Original strand, 5415292 - 5415504
Alignment:
| Q |
15 |
cacagataacaaaatggattgagaaaggcgaagaagaaattacaagaggaacaacatgnnnnnnnttacaagaagcaggaaaaatattacaagaaagaaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
5415292 |
cacagataacaaaatggattgagaaaggcgaagaagaaattacaagaggaacaacatgaaaaaaattacaagaagcaggaaaaatattacaagaaagaaa |
5415391 |
T |
|
| Q |
115 |
gggagttccctgtcatcgaatgggtggaagatggatcaaaaccctatcttcccttttatataacaatacgaagaacgcgttctttttctgctttgctatc |
214 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5415392 |
gggagttccctgtcagcgaatgggtggaagatggatcaaaaccctatcttcccttttatataacaataccaagaacgcgttctttttctgctttgctatc |
5415491 |
T |
|
| Q |
215 |
cacaccttacttt |
227 |
Q |
| |
|
||||||||||||| |
|
|
| T |
5415492 |
cacaccttacttt |
5415504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 131 - 180
Target Start/End: Original strand, 18969385 - 18969434
Alignment:
| Q |
131 |
cgaatgggtggaagatggatcaaaaccctatcttcccttttatataacaa |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
18969385 |
cgaatgggtggaagatggatcaaaaccctatcatcccttttatataacaa |
18969434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 16 - 69
Target Start/End: Original strand, 18969302 - 18969355
Alignment:
| Q |
16 |
acagataacaaaatggattgagaaaggcgaagaagaaattacaagaggaacaac |
69 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||| | |||||||| |||||| |
|
|
| T |
18969302 |
acagaaaacaaaatgggttgagaaaggcgaagaagacaatacaagagcaacaac |
18969355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University