View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15317_low_38 (Length: 242)
Name: NF15317_low_38
Description: NF15317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15317_low_38 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 2e-95; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 177
Target Start/End: Original strand, 2318646 - 2318822
Alignment:
| Q |
1 |
tgagaaatggtgttttgtacaatgcgttgtcaaatagcggcgctgtaacaatagaattcaaacaaaatgcgattttttgcaatccacaatggacaacatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2318646 |
tgagaaatggtgttttgtacaatgcgttgtcaaatagcggcgctgtaacaatagaattcaaacaaaatgcgattttttgcaatccacaatggacaacatt |
2318745 |
T |
 |
| Q |
101 |
gattaagacttacctaattgataaccttatattcattttcacgcggaaaaaatgagacaatgttgtttgatgaatcc |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2318746 |
gattaagacttacctaattgataaccttatattcattttcacgcggaaaaaatgagacaatgttgtttgatgaatcc |
2318822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 16 - 106
Target Start/End: Original strand, 2309526 - 2309615
Alignment:
| Q |
16 |
tgtacaatgcgttgtcaaatagcggcgctgtaacaatagaattcaaacaaaatgcgattttttgcaatccacaatggacaacattgattaa |
106 |
Q |
| |
|
||||||||| ||||||||||||||| ||| ||||| ||||||| | ||||||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
2309526 |
tgtacaatgtgttgtcaaatagcggtgctttaaca-tagaatttgatcaaaatgttatttttcgcaatccacaatggacaacattgattaa |
2309615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 194 - 224
Target Start/End: Original strand, 2318837 - 2318867
Alignment:
| Q |
194 |
ggcaacccgagtataaagctcccgcatatct |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
2318837 |
ggcaacccgagtataaagctcccgcatatct |
2318867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University