View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15317_low_43 (Length: 231)
Name: NF15317_low_43
Description: NF15317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15317_low_43 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 21 - 218
Target Start/End: Original strand, 19091242 - 19091439
Alignment:
| Q |
21 |
tttggtttatgtagtcgaaccatttcatatgttttcatctcatatgtaactcatgatctgcagttgccttatatatcggaacttacttgctggcttcaag |
120 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19091242 |
tttggtttatgtagttgaaccatttcatatgtttttatctcatatgtaactcatgatctgcagttgccttatatatcggaacttacttgctggcttcaag |
19091341 |
T |
|
| Q |
121 |
acatgcatggaaatagatagatacatgcgtgaagagatgccaaatggatctacagatgaaaatggaacatttgttgcacattataatgtgagtataat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
19091342 |
acatgcatggaaatagatagatacatgcgtgaagagatgccaaatggatctacagatgaaaatggaacatttgttgcacagtataatgtgagtataat |
19091439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University