View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15318_low_26 (Length: 242)
Name: NF15318_low_26
Description: NF15318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15318_low_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 35109378 - 35109600
Alignment:
| Q |
1 |
agtaatttgctaaaattacctcactgcataggagtatctatctattctgcaccacaaattccttcaattcataagccttgcctccatatattttactttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
35109378 |
agtaatttgctaaaattacctcactgcataggagtatctatctattcttcaccacaaattccttcaattcataagccttgcttccgtatattttactttg |
35109477 |
T |
|
| Q |
101 |
taatnnnnnnn-tacaatatcatgcattttactaggaaaattgttaattgactctttaggtagttcatattaatgaattgcaatttttgacaacctgcag |
199 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35109478 |
taaaaaaaaaaatacaatatcatgcattttactaggaaaattgttaattgactctttaggtagttcatattaatgaattgcaatttttgacaacctgcag |
35109577 |
T |
|
| Q |
200 |
aaaggaatacgttatggcaaatca |
223 |
Q |
| |
|
||||||||| |||||||||||||| |
|
|
| T |
35109578 |
aaaggaata-gttatggcaaatca |
35109600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University