View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15319_high_2 (Length: 237)
Name: NF15319_high_2
Description: NF15319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15319_high_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 195
Target Start/End: Complemental strand, 48010246 - 48010044
Alignment:
| Q |
1 |
aagccaaggaactaacgagaacgttatggtgaggatcgatgacgctagatatggatcgtgtttatgagatatcgatatgatgatatcaatatggtgaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | |
|
|
| T |
48010246 |
aagccaaggaactaacgagaacgttatggtgaggatcgatgacgctagatatggatcgtgtttatgagatattgatatgatgatatcaatatggtgaaga |
48010147 |
T |
 |
| Q |
101 |
tcactgttgagattgagaacgattcagtgtatatggagagtggagaaaaacgtgtatgtatg--------tatggtgtgctagagaaatgctaaacctaa |
192 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
48010146 |
tcgctgttgagattgagaacgattcagtgtatatggagagtggagaaaaacgtgtatgtatgtatgcatgtatggtgtgctagagaaatgctaaacctaa |
48010047 |
T |
 |
| Q |
193 |
ttc |
195 |
Q |
| |
|
||| |
|
|
| T |
48010046 |
ttc |
48010044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University