View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1531_1D_high_12 (Length: 417)
Name: NF1531_1D_high_12
Description: NF1531_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1531_1D_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 253; Significance: 1e-140; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 71 - 388
Target Start/End: Original strand, 45634915 - 45635232
Alignment:
| Q |
71 |
aaggatttggaggactgccgtaaacagctagaattgatgtgcaacagtcatgtgggggaatctcaggatcagctgctgcatttgcgcnnnnnnntgaacc |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| | | ||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
45634915 |
aaggatttggaggactgccgtaaacagctagaattgatgcgtagcagtcatgtgggggaatcttaggatcagctgctgcatttgcgcaaaaaaatgaacc |
45635014 |
T |
 |
| Q |
171 |
aataccttctgcaagatgaagcatactgacaacaacgtgctaaaaaacattggtacaaagatggagacaaaaacaccaaaattttccatgctttcgcctc |
270 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
45635015 |
aataccttctgcaagatgaagcatactggtgacaacgtgctaaaaaacattggtacaaagatggagacaaaaacaccaaatttttccatgcttccgcctc |
45635114 |
T |
 |
| Q |
271 |
cgctagaaagaaggttaatcgtatcctttctctagagaatgatcagggtgttgaagtgaccaataattcagatatgtgtgttgtggctaaagagtatttt |
370 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45635115 |
cgctagaaagaaggttaatcgtatcctttctctagagaatgatcagggtgttaaagtgacaaataattcagatatgtgtgttgtggctaaagagtatttt |
45635214 |
T |
 |
| Q |
371 |
gatgatttgtttcaacgg |
388 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
45635215 |
gatgatttgtttcaacgg |
45635232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 230 - 303
Target Start/End: Original strand, 41329332 - 41329405
Alignment:
| Q |
230 |
gatggagacaaaaacaccaaaattttccatgctttcgcctccgctagaaagaaggttaatcgtatcctttctct |
303 |
Q |
| |
|
||||||||| | ||||||||| |||||||||||| ||| | |||||||||||||| |||| ||| ||||||| |
|
|
| T |
41329332 |
gatggagaccacaacaccaaatttttccatgcttccgctacggctagaaagaaggtaaatcatattatttctct |
41329405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000006; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 13 - 66
Target Start/End: Original strand, 1531208 - 1531261
Alignment:
| Q |
13 |
ctctctctgccatcgctgtatttaagcatgaacctacaacttgtgtgagtggtc |
66 |
Q |
| |
|
|||||||| | || ||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1531208 |
ctctctctccaatggctatatttaagcatgaacctccaacttgtgtgagtggtc |
1531261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 202 - 263
Target Start/End: Original strand, 22185914 - 22185975
Alignment:
| Q |
202 |
acaacgtgctaaaaaacattggtacaaagatggagacaaaaacaccaaaattttccatgctt |
263 |
Q |
| |
|
|||||| ||||||| ||||||||||||| ||||||| | ||||||||||| ||| ||||||| |
|
|
| T |
22185914 |
acaacgcgctaaaacacattggtacaaaaatggagatagaaacaccaaaaattttcatgctt |
22185975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 218 - 290
Target Start/End: Original strand, 20927318 - 20927390
Alignment:
| Q |
218 |
cattggtacaaagatggagacaaaaacaccaaaattttccatgctttcgcctccgctagaaagaaggttaatc |
290 |
Q |
| |
|
|||||||| || ||||||||||| ||||||||| |||||||||||| ||| | ||||||| |||||| |||| |
|
|
| T |
20927318 |
cattggtagaaggatggagacaacaacaccaaatttttccatgcttccgctacggctagaaggaaggtaaatc |
20927390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University