View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1531_1D_high_19 (Length: 294)
Name: NF1531_1D_high_19
Description: NF1531_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1531_1D_high_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 5e-93; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 13 - 205
Target Start/End: Original strand, 11833583 - 11833775
Alignment:
| Q |
13 |
tggacatcaacgttgcagatccgaaagtatggaaaactatgcatagtggcaaagccaccgttcacacgataatgccccacattcaaaatccatgtcattg |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| | |
|
|
| T |
11833583 |
tggacatcaacgttgcagatccgaaagtatggaaagctatgcatagtggcgaagccaccgttgacacgataatgccccacattcaaaatccatgtcatcg |
11833682 |
T |
 |
| Q |
113 |
acgtcatgcattgtcgttagatggataacggttatgggtgaaatggtagaaagatttcttcctagtgctttctagatctctttgttcgggttc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11833683 |
acgtcatgcattgtcgttagatggataacggttatgggtgaaatggtagagagatttcttcctagtgctttctagatctctttgttcgggttc |
11833775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 214 - 294
Target Start/End: Original strand, 11833802 - 11833882
Alignment:
| Q |
214 |
tctctctatatgtatgtctcttagttgttggattaatccaacttctagccataacgcaaaagagatgattacatggacgag |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11833802 |
tctctctatatgtatgtctcttagttgttggattaatccaacttctagccataacgcaaaagagatgattacatggacgag |
11833882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 4 - 44
Target Start/End: Complemental strand, 7677876 - 7677836
Alignment:
| Q |
4 |
gcaatgagatggacatcaacgttgcagatccgaaagtatgg |
44 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
7677876 |
gcaatgatttggacatcaacgttgcagatccgaaagcatgg |
7677836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University