View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1531_1D_high_24 (Length: 263)
Name: NF1531_1D_high_24
Description: NF1531_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1531_1D_high_24 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 24 - 263
Target Start/End: Complemental strand, 40173668 - 40173426
Alignment:
| Q |
24 |
gtattatcagttacataacagaactcttccaccttaggtgcacagatctcctcgtatttactgccaaattcaaaccaatttatatagccttatggaatac |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40173668 |
gtattatcagttacataacagaactcttccaccttaggtgcacagatctcctcgtatttactgccaaattcaaaccaatt--tatagccttatggaatac |
40173571 |
T |
|
| Q |
124 |
aaatacaaataaaaatgcaggacaaacacaagaaaacaattgaaacaagcactg----gtgaaacaaattaagtagatattccataacaaacaataacta |
219 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| || ||||||||| |||||| |||||||||||||||| | |||||||||||||||| |
|
|
| T |
40173570 |
aaatacaaataaaaatgcagtacaaacacaagaaaacaatttaatcaagcactgtatagtgaaaaaaattaagtagatattacttaacaaacaataacta |
40173471 |
T |
|
| Q |
220 |
agagagaagaa-cctacgcagcaatcatcatgcaggtaacaccaa |
263 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40173470 |
agagagaagaaccctacgcagcaatcatcatgcaggtaacaccaa |
40173426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 27 - 90
Target Start/End: Complemental strand, 40181557 - 40181494
Alignment:
| Q |
27 |
ttatcagttacataacagaactcttccaccttaggtgcacagatctcctcgtatttactgccaa |
90 |
Q |
| |
|
|||||||||| |||||| || || ||||||| ||||||||| |||||||| ||||||||||||| |
|
|
| T |
40181557 |
ttatcagttatataacaaaattcctccacctgaggtgcacaaatctcctcatatttactgccaa |
40181494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University