View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1531_1D_high_25 (Length: 258)
Name: NF1531_1D_high_25
Description: NF1531_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1531_1D_high_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 35464505 - 35464258
Alignment:
| Q |
1 |
taatgtcggagatgttgcgatacattattannnnnnnn---cttttctttctatctacatgaaatagaaaaattgtttaagacaattgaagcacatggaa |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35464505 |
taatgtcggagatgttgcgatacattattattattttttttcttttctttctatctacatgaaatagaaaaattgtttaagacaattgaagcacatggaa |
35464406 |
T |
|
| Q |
98 |
ttataaaatatgtacaagaagctttggatcttttagtcnnnnnnnnnnnngaagcttggctcgatgtttttataaattttgacctagctcccttaaaaaa |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35464405 |
ttataaaatatgtacaagaagctttggatcttttagtcaaaaataaaaaagaagcttggctcaatgtttttataaattttgacctagctcccttaaaaaa |
35464306 |
T |
|
| Q |
198 |
caatgtgacctagctattctatgagcatttcaaatctattagatagta |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
35464305 |
caatgtgacctagctattctatgagcatttcaaatccattagatagta |
35464258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University